Un cas de febre aguda Q amb taca negra a Sàsser del 2012 (Medicina mediterrània, 01/2018)

En la regió mediterrània la presència de taca negra (o tache noir) és considerat un signe de possible de la febre botonosa mediterrània, causada pel bacteri Rickettsia conorii i transmesa per la paparra canina Rhipicephalus sanguineus. D’aquesta malaltia parlàvem el març de l’any passat amb motiu d’un estudi epidemiològic de Herrador et al. que analitzava les 4735 hospitalitzacions amb diagnòstic de febre botonosa mediterrània que havien tingut lloc a Espanya entre el 1997 i el 2014. El juny del 2012 era derivat a la Unitat de Malalties Infeccioses de la Universitat de Sàsser un pacient de 51 anys procedent d’un àrea periurbana que des de feia set dies patia una febre persistent (37,5ºC) acompanyada de mal de cap, malestar general, dolor muscular i tos seca. En examinar-lo li van trobar en la superfície medial inferior de la cama dreta una lesió cutània amb crosta fosca envoltada per un eritema circular. La lesió tenia pinta d’ésser el resultat d’una picada de paparra i, en efecte, el pacient declarà que n’havia patit una. Davant d’aquesta taca negra, el metge diagnosticà una possible febre mediterrània botonosa, i li receptaren dosis de 100 mg de doxiciclina cada 12 hores. Dues setmanes després, la taca i la resta de símptomes havien remès. Les dades de laboratori, però, indicaren que l’agent infecciós era Coxiella burnetii, i que no era un cas de febre botonosa sinó de febre Q. Cinc anys després, el cas fou tramès per a publicació a la revista Medical Principles and Practice en forma d’article, que l’acceptà després d’un procés de revisió ahir 3 de gener. El cas, per als autors de l’article, mostra com, si bé la taca negra a la regió mediterrània és un signe patognomònic de la febre botonosa mediterrània, cal no descartar la febre Q. Així, la realització de tests diagnòstics de laboratori acurats seria necessària per fer-hi un diagnòstic clínic que condueixi al tractament adequat.

Electrografia que mostra una cèl·lula Vero (colorejada en vermell) amb una vacuola plena de cèl·lules de “Coxiella burnetii” (colorejades en verd)

La Unitat de Malalties Infeccioses del Departament de Medicina Clínica i Experimental de la Universitat de Sassari

L’any passat la Universitas Turritana Sacerensis commemorava el Quart Centenari de la seva fundació oficial, en temps del rei Felip III. Si l’Estatut d’Universitat Règia era expedit pel monarca el 9 de febrer del 1617, cal dir que ja des de 1562, la municipalitat havia bastit cursos universitaris a través de l’Ateneo fundat pel llegat d’Alessio Fontana. Actualment s’estructura en tretze departaments, un dels quals és el de Medicina Clinica e Sperimentale.

Dins d’aquest Departament es troba la Unitat de Malalties Infeccioses, que és la que atengué el cas esmentat del juny del 2012. A més de Vito Fiore, l’autor corresponent, signen també el report del cas Paola Bagella, Francesca Peruzzu, Sergio Babudieri i Giordano Madeddu. També participa en el report Giovanni Andrea Deiana, de la Unitat de Neurologia del mateix centre, així com Fabiola Mancini i Alessandra Ciervo, del Departament de Malalties Infeccioses, Parasitàries i Immunomediades de l’Istituto Superiore di Sanità, de Roma; i Giuseppe Nunnari, de la Divisió de Malalties Infeccioses del Departament de Medicina Clínica i Experimental de la Universitat de Messina.

Un cas de taca negra en un pacient febrós de 51 anys d’un àrea periurbana de Sassari

Quan el pacient fou derivat a la Unitat de Malalties Infeccioses ja duia una setmana amb febre, tos, mal de cap i malestar general. En examinar-lo, li van trobar una tache noir a la cama dreta, és a dir una crosta fosca compatible amb la cicatriu d’una picada de paparra. La taca negra era acompanya d’edema i d’un eritema circular, però no hi havia erupció maculopapular. El mateix pacient recordava haver estat picat per una paparra. L’exam físic cardiopulmonar i abdominal no detectà cap alteració. De les anàlisis realitzades, tan sols es detectava una limfo-monocitosi i un augment lleuger de la proteïna reactiva C.

Donada la tache noir, que és considerada un signe patognomònic, si més no a l’àrea mediterrània, de la febre botonosa mediterrània produïda per Rickettsia conorii, el metge optà per seguir el tractament d’elecció davant d’aquesta malaltia: 100 mg de doxiciclina cada dotze hores.

Estructura química de la doxiciclina. L’any passat es commemorà el 50è aniversari de la introducció d’aquest antibiòtic, que és considerat una de les medicines essencials per a l’OMS, tant pel seu ampli espectre o pel seu baix cost

Es demanaren anàlisis serològiques per a diferents espècies de Rickettsia i per Anaplasma phagocytophilum, Ehrlichia canis, Bartonella henselae i Coxiella burnetii. També es va fer una ELISA per a Rickettsia conorii i per a diferents espècies de Borrellia. Totes les anàlisis donaren negatives, excepte Coxiella burnetii, de la qual s’estimà una titulació d’anticòs IgG de fase II i I de 1:50.

Abans d’iniciar el tractament, es practicà una biòpsia cutània de la taca negra, que fou recollida en tampó PBS. D’aquesta mostra de pell, així com d’una mostra de sang total, es va fer una extracció d’ADN. Aquest ADN fou sotmès a una PCR de temps real amb els primers gltA-F TCGCAAATGTTCACGGTA i gltA-R TCGTGCATTTCTTTCCATTGTG: l’amplificació positiva hauria estat signe de la presència de Rickettsia (a través de la presència del gen de la citrat-sintasa). Ni la biòpsia ni la sang, però, no donaren pas positiu.

El pacient continuà a casa el tractament durant 14 dies, aconseguint una remissió clínica completa. Conclòs el període, però, es repetiren les anàlisis serològiques. De nou totes donaren negatiu, excepte Coxiella que en aquesta ocasió mostrà un resultat clarament positiu, amb una titulació sis vegades superior a la primera serologia.

Un cas de febre Q

De la mateixa manera que les Rickettsia, Coxiella burnetii és un bacteri Gram-negatiu que tan sols pot proliferar a través de la infecció intracel·lular. Ho pot fer a l’interior de diversos tipus cel·lulars de diverses espècies de vertebrats. En l’ésser humà és l’agent causal de la febre Q.

La febre Q es diu així per la “query” (enigma) que suposà per a qui la va descriure en el 1935, Edward Holbrook Derrick (1898-1976). Derrick havia assumit l’any anterior la direcció del Laboratori de Microbiologia i Patologia del Departament de Salut de Queensland, amb seu a Brisbane. Diversos treballadors de l’escorxador de Brisbane havien mostrat una febre que recordava les produïdes per rickèttsies, però les anàlisis microbiològiques i serològiques havien resultat negatives en aquest sentit. No fou fins el 1937, que Frank Macfarlane Burnet (1899-1985) i Mavis Freeman isolaren el bacteri responsable, que assignaren com a una nova espècie de Rickettsia. En el 1938, H. R. Cox (1907-1986) i Gordon Davis detectaren la presència d’aquesta mateixa espècie en paparres de Montana. Eventualment, hom reclassificà aquesta Rickettsia dins d’un gènere nou, Coxiella, en honor de Cox, mentre se li donava l’adjectiu de burnetii en un homenatge a Frank Macfarlane. Burnet, però, és més conegut per la seva teoria de la tolerància immunitària adquirida, que li valdria el Premi Nobel de Medicina del 1960.

La qüestió de la transmissió de Coxiella burnetii trigà en ser aclarida. D’acord amb Burnet, s’assumí que la transmissió era per inhalació d’aerosols contaminats o per la ingesta de llet contaminada. Però, tal com suggeria Cox, en el 1947 es demostrà que les paparres podien trasmetre-la en humans.

Des dels anys 1970 se sap que la febre Q és endèmica en grans parts d’Europa, i en algunes contrades rurals fins a un 10-30% de la població presenta anticossos contra C. burnetii. És possible que sovint la infecció no sigui simptomàtica. Quan ho és cursa com una febre aguda, d’aparició sobtada, acompanyada de mal de cap, esgarrifances, tos i miàlgia, amb possibles complicacions pulmonars i hepàtiques. Ara bé, la “taca negra” o “botó fosc” no fa part de la descripció clínica de la febre Q.

Fiore et al. pensen que aquest cas del juny del 2012, atribuït inicialment a la febre mediterrània botonosa, es degué a C. burnetii. El grup de Giordano Madeddu ha estimat que la febre Q és responsable del 8% de malalties febrils agudes en la primavera-estiu de Sardenya. No és pas tan comuna com la febre botonosa mediterrània (deguda a Rickettsia conorii o, més rarament, R. monacensis) que, com altres rickettsiosis, és considerada endèmica a l’illa. Ara bé, aquest és el primer cas que s’han trobat de “tache noir” associada a la febre Q aguda.

En el cas que descriuen el tractament amb doxiciclina durant dues setmanes fou efectiu, però Fiore et al. alerten que les infeccions per C. burnetii, si es compliquen, no responen als tractaments habituals de les rickettsiosis. Així, suspendre el tractament a les dues setmanes, podria haver suposat un risc potencial de deixar cronificar la infecció.

La raó per la qual la “tache noir” no apareix en la descripció de la febre Q és que normalment aquesta malaltia no és transmesa per paparres. Fiore et al. citen un estudi realitzat a Algèria en el 2016 per Leulmi et al. en el qual estimaven que un 16% de les paparres de l’espècie Ixodes vespertilionis donaven positiu en els tests d’ADN de C. burnetii. Satta et al. (2011), d’altra banda, indicaven la presència de C. burnetii en paparres de Sardenya (Rhipicephalus sanguineus, Rhipicephalus turanicus, Haemaphysalis sulcata) adquirides arran de picar gossos o cabres.

Coxiella burnetii és considerada una zoonosi mundial. Fernandez-Aguilar et al. (2016) han estudiat la interacció entre reservoris salvatges i domèstics de remugants al Pirineu Oriental. Els reservoris animals són múltiples, i les paparres semblen jugar un paper rellevant en connectar-los, especialment pel que fa als reservoris salvatges de rosegadors, lagomorfs i aus. Com s’ha dit, la majoria d’humans infectats per C. burnetii ho fan a través d’aerosols, però les picades de paparres com R. sanguineus o R. microplus poden jugar també un paper.

Fiore et al. consideren que el cas de febre Q que exposen contragué la malaltia arran de la picada d’una paparra de l’espècie “Rhipicephalus sanguineus”, la denominada paparra bruna del gos. Aquesta és paparra és de distribució ecumènica, si bé és més comuna en climes càlids. Les paparres són aràcnids del grup dels Acari: la seva hematofàgia obligada els converteix en ectoparàsits. Si bé poden resistir en l’ambient sense picar un temps considerable, no poden completar el seu cicle vital sense picar

Fiore et al. conclouen que la presència de “tache noire” no hauria de conduir a descartar altres possibilitats que la febre botonosa mediterrània. La diagnosi clínica s’hauria d’acompanyar de tests diagnòstics de laboratori acurats (serologia, PCR) per tal d’identificar el patogen responsable i seleccionar el tractament més adient.

Lligams:

Tache Noire in a Patient with Acute Q Fever. Vito Fiore, Fabiola Mancini, Alessandra Ciervo, Paola Bagella, Francesca Peruzzu, Giuseppe Nunnari, Giovanni Andrea Deiana, Giovanni Rezza, Sergio Babudieri, Giordano Madeddu. Med. Princ. Pract. doi.org/10.1159/000486573 (2018)

 

Arxivat a Ciència i Tecnologia
3 comments on “Un cas de febre aguda Q amb taca negra a Sàsser del 2012 (Medicina mediterrània, 01/2018)
  1. Jordi Camps i Vergés ha dit:

    Jo vaig patir una picada d’una paparra, garreny que en diem nosaltres a St. Feliu de Guíxols, o llagasta. Efectivament la definició que feu Vós del Botó Negre (Tache Noire), correspon amb la que em van trobar a mi al lateral dret superior del peu dret després d’alguns dies de patir febre. Patia esgarrifances i febre alta i els metges sense trobar-ne les causes. Sortosament no em van haver d’hospitalitzar, doncs el medicament que em va aplicar el metge (quan en ensenyar-li el Botó Negre, al moment em diagnosticà la causa) em va guarir en pocs dies.
    Però coi, es veu que la maleïda paparra es deuria trobar bé a casa perquè, quan jo ja m’havia guarit de la malaltia, la meva esposa patí el mateix procés, si bé més complicat, puix hi havia absència del botó negre. La van haver d’hospitalitzar, i sort que jo insistia als metges -els quals per cert no trobaven les causes de la seva febre- del què m’havia passat a mi. Llavors van fer analítiques, i efectivament van dictaminar que la causa de la meva esposa era el mateix que em passà a mi.
    I ara si em permeteu, m’agradaria preguntar-vos si a causa d’això, ara tant ella com jo estem immunitzats?
    Moltes mercès per anticipat.

    • didaclopez ha dit:

      Gràcies per exposar aquest cas, que mostra les dificultats de diagnòstic quan hi ha absència de la tache noire. Pel que fa a la immunitat aquesta no és completa i tendeix a perdre’s amb el temps, a mesura que decauen els anticossos contra la rickettsia

      • Jordi Camps i Vergés ha dit:

        Moltes mercès per la resposta. Bé doncs, hauré d’anar en compte, doncs visc al bell costat del bosc i més a més tinc gossos.

Podeu escriure el vostre comentari aquí:

Fill in your details below or click an icon to log in:

WordPress.com Logo

Esteu comentant fent servir el compte WordPress.com. Log Out / Canvia )

Twitter picture

Esteu comentant fent servir el compte Twitter. Log Out / Canvia )

Facebook photo

Esteu comentant fent servir el compte Facebook. Log Out / Canvia )

Google+ photo

Esteu comentant fent servir el compte Google+. Log Out / Canvia )

S'està connectant a %s

%d bloggers like this: