‘Ooencyrtus zoeae’ i ‘O. mevalbelus’: dues espècies d’himenòpters parasitoids de nova descripció (Entomologia mediterrània, 45/ 2018)

La setmana passada en comentar uns resultats esperançadors de Ahmad et al. sobre l’aplicació de la tècnica d’introducció de mascles estèrils per combatre plagues de la mosca de l’oliva esmentàvem de volada el fet que contra aquesta plaga també s’ha proposat i aplicat una tècnica de control basat en Opius concolor, un himenòpter parasitoid. Diem parasitoids perquè aquests insectes es troben a mig camí entre els paràsits i els depredadors. Si la mosca de l’oliva ovoposita fent una punxada en l’oliva, Opius concolor ovoposita fent una punxada a larves de la mosca de l’oliva ja properes a l’estadi pupal. O. concolor farà tot el seu desenvolupament ja dins de la pupa de la mosca de l’oliva, una vegada aquesta és en terra, i d’ella emergirà com a adult “substituint” a la mosca, que ja no emergirà pas, en haver estat devorada pel parasitoid. Hi ha una bona diversitat d’himenòpters parasitoids. Si O. concolor (de la família dels bracònids i de la superfamília dels icneumonoideus) emergeix de l’estadi pupal de l’hoste, el gènere Ooencyrtus (de la família dels encírtids i de la superfamília dels calcidoideus) ho fa de l’estadi oval. Diverses espècies d’Ooencyrtus han rebut interès perquè són parasitoids de plagues agrícoles i forestals. L’aprofitament d’aquestes espècies requereix, però, un bon coneixement taxonòmic. En les pàgines de PLoS One llegim aquesta setmana un article encapçalat per Shahar Samra, del Departament d’Entomologia del Centre Volcani de Beit Dagan (centre del qual també vam parlar indirectament la setmana passada) que ofereix dades moleculars, morfològiques i biològiques per al conjunt d’espècies de Ooencyrtus que parasitoiditzen ous de la xina variegada de camp (Stenozygum coloratum) a la Regió Mediterrània Oriental. Samra et al., d’acord amb les seqüències COI, diferencia sis clades divergents, i amb les seqüències ITS2, en resulten cinc. Tres d’aquests clades els identifiquen amb espècies ja conegudes: O. telenomicida, O. pityocampae i O. pistaciae. A partir d’altres dos clades, Samra et al. descriuen dues noves espècies, O. zoeae i O. mevalbelus. En aquest article, a més d’aquesta descripció, ofereixen als especialistes claus dicotòmiques de diferenciació a partir de caràcters morfològics. Val a dir, que no és una tasca fàcil: parlem d’insectes molt petits i d’una variabilitat morfològica i ecològica considerables. Samra et al. recolzen la classificació que proposen en estudis d’hibridació que mostren l’isolament reproductiu entre les cinc espècies citades. El més rellevant, és clar, és el fet de mostrar que S. coloratum és un hoste per a aquestes cinc espècies de parasitoids, ja que obre la porta a utilitzar cultius d’ous d’aquesta xinxa de camp per amplificar-les de manera controlada de cara a programes de control de les plagues agrícoles i forestals sensibles a aquest parasitoidisme.

Ovoposició de ‘Ooencyrtus telenomicida’ en ous d’‘Eurydema’, en el canal d’H. Dumas. És un exemple de parasitoidisme oòfag

Espècies d’Ooencyrtus que parasitoïditzen ous de la xina de camp Stenozygum coloratum

Un adult de la xinxa variegada de les tapereres (‘Stenozygum coloratum’), fotografiat per Nir Ofir en el 2007

Aquesta recerca fou concebuda pel professor Murad Ghanim, investigador del Departament d’Entomologia del Volcani Center de Beit Dagan. En el disseny metodològic també participà, al costat de Ghanim, Shahar Samra (entomòleg del Volcani Center, i també de la Facultat d’Agricultura de la Universitat Hebrea de Jerusalem, a Rehovot).

En l’obtenció de dades participaren, al costat de Samra, Pasquale Cascone (de l’Istituto per la Protezione Sostenibile delle Piante, de Puortece), John Noyes (del Department of Life Sciences del Natural History Museum, de Londres) i Emilio Guerrieri (de l’IPSP de Puortece). L’anàlisi formal la féu Samra. En la investigació participaren Samra, Cascone, Noyes, Alex Protasov (del Volcani Center), Guerrieri i Zvi Mendel (del Volcani Center). La visualització de les dades la realitzà Protasov. La validació anà a càrrec de Noyes i Guerrieri.

El finançament de la recerca es va fer a través del Keren Kayemeth LeIsrael, amb el projecte 131-1619-13, que va a nom de Shahar Samra, i que fou obtingut a través de Mendel. L’administració del projecte la va fer Mendel, que també supervisà la investigació al costat de Ghanim. Samra i Guerrieri van fer un primer esborrany, després revisat per ells dos i per Noyes i Mendel.

L’article fou tramès a PLoS One el 22 de juliol del 2018. Yue Bi-Song, de la Universitat de Sichuan, en fou l’editor, i la versió definitiva fou acceptada el 19 de setembre, i publicada el 7 de novembre. Paral·lelament les seqüències genètiques s’han publicat al GeneBank.

Del gènere Ooencyrtus s’han descrit més de 300 espècies. La identificació específica és complicada fins i tot als experts (com Noyes o Guerrieri) quan només es fan servir caràcters morfològics, com el color de les extremitats, la venació de les ales, la proporció de les antenes o genitals. La identificació específica no és una mera qüestió acadèmica, ja que pot ésser rellevant en l’èxit o fracàs de l’ús d’aquests himenòpters parasitoids en la lluita contra plagues agrícoles i forestals.

Un exemple d’aquest ús es troba en Ooencyrtus pityocampae Marcet, que parasitoiditza ous de la processionària del pi (és a dir el complex d’espècies de Thaumetopoea pityocampae Den and Schiff i T. wilkinsoni Tams, lepidòpters de la família dels notodòntids que fan aquells nius tan característics en els pins). La processionària del pi és una plaga defoliadora important per als pins de Conca Mediterrània, a la qual cosa hem d’afegir les reaccions al·lèrgiques que produeixen en humans aquestes erugues. Val a dir que O. pityocampae no només ataca a la processionària del pi sinó a un ample ventall de lepidòpters i heteròpters. Això darrer facilita el cultiu en el laboratori d’O. pityocampae en ous dels insectes apropiats. No fa pas gaire, el grup de recerca de Samra, va identificar la presència d’O. pityocampae en ous de la xina variegada del camp Stenozygum coloratum (Klug). Aquesta espècie d’hemípter de la família dels pentatòmids es distribueix per l’Orient Mitjà i l’Àfrica Oriental, i a Israel li diuen la xinxa de taperera perquè se la troba en aquesta planta.

És interessant a Israel la relació que es produeix entre les tapereres (Capparis spp.) i els pins, quan aquelles plantes fan part de pinedes o hi són a les vores. S. coloratum fa oviposicions damunt les tapereres entre maig i setembre. Alhora, O. pityocampae fa oviposicions damunt dels ous de S. coloratum en aquest mateix període. L’oviposició de la processionària del pi es fa entre setembre i novembre. Per això, el grup de Samra pensa que O. pityocampae fa una alternança entre els dos hostes: a l’estiu sobre S. coloratum i a la tardor sobre T. pityocampae. En certa manera, podem dir que S. coloratum constitueix un reservori per a O. pityocampae durant l’estiu, essencial per conservar la població d’aquest parasitoid, i que cal considerar si hom vol fer-lo servir en el control a Israel de la plaga de processionària del pi.

En investigar aquestes associacions, el grup de Samra trobà que els ous de S. coloratum són parasitats per altres espècies d’Ooencyrtus. És per això que Ghanim proposà un estudi integrat, morfològic, biològic i genètic sobre aquestes espècies.

Recol·leccions de mostres entre el 2010 i el 2013

En aquest estudi es treballà sobre recol·leccions d’agregats d’ous de S. coloratum fetes entre el 2010 i el 2013 en diferents localitats d’Israel (Gilboa, Yatir, Biriya, Haruvit, Lahav, Eshta’ol, Rosh Pinna, Eyn-Gev, Avdat) i de Turquia (Antakya, Karataş, Tarsus)..

Els agregats d’ous eren col·locats en tubs de vidre (de 15 mm d’ample i 10 cm de llarg) tapat amb cotó fluix, i que eren conservats en el laboratori a 25°C, a 40-60% d’humitat i amb un cicle estival de 14 hores de llum i de 10 de foscor. Els tubs eren revisats, i gairebé cada parasitoid que hi emergia, era transferit directament a un tub Eppendorf amb etanol 96%, que era congelat a -20°C.

De cada localitat, però, es conservaren vius una parella de parasitoids: les parelles eren transferides a un tub de vidre. Després se subministrava a les femelles ous bé de S. coloratum o de Bombyx mori (cucs de seda), procedents dels cultius d’insectes que tenen a Beit Dagan.

De les cries d’aquesta parella, se n’agafaven algunes per fer estudis moleculars (prèvia conservació en etanol al 96%) o per fer estudis morfològics (prèvia conservació en etanol al 80%). La majoria, però, de les cries foren conservades per tal d’amplificar el cultiu en laboratori de parasitoids de cada mostreig individual.

La caracterització molecular de 274 individus d’Ooencyrtus

L’anàlisi genètica es practicà sobre 274 individus d’Ooencyrtus, tots ells nascuts d’ous de S. coloratum recollits d’indrets d’Israel i del sud de Turquia. Com a control extern s’emprà un individu de O. kuvanae nascut d’ous de Lymantria dispar recollits de Maryland. Se’n féu una extracció d’ADN genòmic total de cada vespa individual.

L’anàlisi genètica consistí en dues amplificacions:
– una d’un fragment de 946 parells de nucleòtids del gen de la citocrom oxidasa 1 (COI). Els encebadors (5’CTCGAATAAATAATATAAGATTTTG3′ i 5′ CAACATAAATAAGAATCTGGA3′) foren facilitats per Marie-Anne Auger-Rozenberg, de la Unité de Zoologie Forestière de l’INRA d’Orléans.
– una d’un fragment de 889-933 parells de nucleòtids que inclou part (65 parells de nucleòtids) del gen ribosomal 5,8S, la seqüència completa (481-525 parells de nucleòtids) de la regió interespaciadora 2 ribosoma (ITS2) i part (342 parells de nucleòtids) del gen ribosomal 28S. Els encebadors utilitzats foren 5’GAACTGCAGGACACATGAACA3′ i 5’CTTGTTCGCTATCGGTCTCGTGGT3′, dissenyats per Samra et al.

Els amplicons resultants foren seqüenciats, i les seqüències obtingudes foren publicades al GeneBank.

La caracterització morfològica

Els espècimens conservats en etanol 80% eren dessecats i muntats en un cartró. Una part dels espècimens foren muntats en portaobjectes per a l’observació microscòpica.

La femella tipus de ‘Ooencyrtus zoeae’ Guerrieri & Samra sp. nov., caracteritzada per les antenes (a), ala anterior (b), venació de l’ala anterior (c), hipopigi (d), ovipositor (e). Del mascle tipus es mostren les antenes (f) i els genitals (g)

Els experiments d’encreuament

D’acord amb la morfologia, Samra et al. classificaren cada població obtinguda en tres morfoespècies.

Els encreuaments es feren tubs de vidre mig omplerts d’arena, on hi col·locaven tres femelles verges d’una espècie i dos mascles d’una altra. Els alimentaven amb una solució d’aiguamel a través d’un tros de roba, i els deixaven tres dies així. Després hi afegien 100 ous de B. mori. Al cap de 3-5 dies, retiraven les vespes adultes, i deixaven covar els ous fins a l’aparició de nous adults. En principi, aquestes espècies només es reprodueixen sexualment, de manera que només apareixen vespes filles si l’encreuament entre les dues espècies és possible.

Cinc espècies detectades: tres conegudes i dues ‘noves’

D’acord amb les seqüències COI analitzades era possible distingir-hi sis clades genèticament diferenciats. En el cas de les seqüències ITS2, el nombre de clades distingibles era de cinc. L’anàlisi morfològica mostrà que tres d’aquests clades es corresponien a espècies ja conegudes: O. pistaciae, O. telenomicida i O. pityocampae. O. pistaciae es corresponia a 1 clade ITS2, diferenciat en dos clades COI.

Dos dels clades identificats per les seqüències COI i ITS2 han estat assignats a dues espècies noves: O. zoeae i O. mevalbelus.

Aquestes cinc espècies són presents en les mostres procedents d’Israel. A les mostres procedents de Turquia es detecten tan sols tres d’aquestes cinc: O. zoeae, O. telenomicida i O. pityocampae.

L’arbre filogenètic quedaria estructurat així:
1.
1. 1.
1. 1. 1. O pistaciae.
1. 1. 2. O. telenomicida.
1. 2.
1. 2. 1. O. mevalbelus.
1. 2. 2. O. zoeae.
2. O. pityocampae

O. kuvanae quedaria externa a aquestes cinc espècies.

Dels 274 individus analitzats en resulten 70 haplotips COI diferents, de manera que cada població té entre 1 i 15 haplotips diferents. La menys diversa és O. pityocampae

Els experiments d’encreuament mostren una barrera reproductiva entre O. mevalbelus, O. zoeae i O. telenomicida. Dels encreuaments entre aquestes espècies només apareix descendència masculina, producte de la partenogènesi.

Com a clau taxonòmica proposen la següent:
– 1. Si tenen potes amb almenys la coxa posterior parcialment de bru marcat anar a 2.
– Si tenen potes, incloses totes les coxes, completament de taronja pàl·lid anar a 3.
– 2. Mesoscutum i scutellum d’un verd fosc metàl·lic: O. pityocampae.
– Mesoscutum i scutellum d’un color majoritàriament de coure: O. pistaciae.
– 3. Cap majoritària d’un verd fosc de metal·licitat brillant (especialment les gena i el rostre inferior): O. mevalbelus.
– Si el cap és generalment apagat, d’un color en general porpre coure, amb verd fosc anar a 4.
– 4. Mesoscutum amb un to moderat de porpre de coure, amb els costats anteriorment d’un verd fosc feblement metàl·lic: O. zoeae.
– Mesocutum amb un to moderart de verd fosc metàl·lic: O. telenomicida.

Detalls morfològics més destacats de ‘Ooencyrtus mevalbelus’ Guerrieri & Samra sp. nov. De la femella es mostren l’antena (a), l’ala anterior (b), la venació de l’ala anterior (c), hipopigi (d), l’ovipositor (e), i del mascle l’antena (f) i els genitals (g).

Les tasques pendents

L’article ofereix una descripció completa de dues noves espècies del gènere Ooencyrtus. També ofereix les relacions filogenètiques entre aquestes espècies i les altres que constitueixen el complex de parasitoids Ooencyrtus spp. que infesten ous de S. coloratum.

Els autors reconeixen que encara queden passes addicionals per completar el procés d’identificació i d’esclariment de les relacions filogenètiques. Hi ha una discrepància entre els resultats genètics ITS2 i COI pel que fa a l’espècie O. pistaciae que podria explicar-se potser per dues subespècies.

També queda per aclarir les raons que expliquen la baixa diversitat genètica interna d’O. pityocampae pel gen mitocondrial COI. Això podria explicar-se per la interferència amb Wolbachia, un bacteri endosimbiont, responsable de l’herència uniparental dels mitocondris en aquestes espècie (en altres espècies de Ooencyrtus spp l’herència és biparental). Un explicació alternativa de la baixa diversitat interna es podria trobar en el fet que O. pityocampae s’hauria expandit a Israel en temps recent acompanyant a l’entrada i dispersió de la processionària del pit en aquest territori.

També queda per aclarir com es relacionen els diferents reservoris d’aquestes espècies en el medi natural, i quina implicació té això per a insectes que produeixen plagues a Israel com Nezara viridula o Aelia spp, per no dir ja a la processionària del pi. Pel que fa a S. coloratum també se l’ha descrit com a plaga agrícola, però en general se’l considera una espècie benigna, en bona mesura restringida a les tapereres silvestres. Samra et al. s’inclinen per pensar que afavorir les poblacions de S. coloratum podria tindre un efecte beneficiós en el control de plagues, particularment de la processionària del pi.

Per aclarir el potencial de Ooencyrtus en control de plagues agrícoles i forestals, Samra et al. consideren necessari elucidar les identitats de les poblacions d’aquestes parasitoids oòfags.

Lligams:

Diversity of Ooencyrtus spp. (Hymenoptera: Encyrtidae) parasitizing the eggs of Stenozygum coloratum (Klug) (Hemiptera: Pentatomidae) with description of two new species. Shahar Samra, Pasquale Cascone, John Noyes, Murad Ghanim, Alex Protasov, Emilio Guerrieri, Zvi Mendel. PLoS One 13: e0205245 (2018).

 

Arxivat a Ciència i Tecnologia

Podeu escriure el vostre comentari aquí:

Fill in your details below or click an icon to log in:

WordPress.com Logo

Esteu comentant fent servir el compte WordPress.com. Log Out /  Canvia )

Google+ photo

Esteu comentant fent servir el compte Google+. Log Out /  Canvia )

Twitter picture

Esteu comentant fent servir el compte Twitter. Log Out /  Canvia )

Facebook photo

Esteu comentant fent servir el compte Facebook. Log Out /  Canvia )

S'està connectant a %s

Aquest lloc utilitza Akismet per reduir els comentaris brossa. Apreneu com es processen les dades dels comentaris.

%d bloggers like this: