Parasitació per tripanorrincs de peixos d’interès comercial a Alexandria (Parasitologia mediterrània, 23/2022)

Els tripanorrincs són un grup de paràsits de peixos que pertanyen a la classe dels cestodes. La infestació muscular que resulta de la parasitació afecta la salut del peix i, de retruc, l’acceptació per part dels consumidors. Aquesta setmana la Revista Brasileira de Parasitologia Veterinária publica un article encapçalat per Kareem Morsy, professor ajudat de parasitologia i zoologia d’invertebrats de la Universitat del Cairo que estudia la presència de larves d’aquests paràsits en peixos comercials del litoral d’Alexandria d’Egipte. Morsy et al. han analitzat 75 espècimens de peixos marins (caràngids: Seriola dumerili, Pseudocarans dentex; serrànids: Epinephelus haifensis, Mycteroperca rubra) tot just capturats. Dels 75 peixos, 45 eren infectats, amb presència de blastocists immersos en la carn. Els investigadors isolaren els blastocists i el trencaren: els plerocercs resultants foren descrits morfològicament com a pertanyents a quatre espècies (Callitetrarhynchus gracilis, C. speciosus, Protogrillotia zerbiae i Grillotia brayi). La seqüenciació del gen 18S rRNA confirmà la identificació morfològica. La presència de metacèstodes en la musculatura d’aquests peixos faria necessari, a parer dels autors, de retirar les zones afectades prèviament a la comercialització del peix.

Plerocercs en la cavitat corporal d’un peix infestat

Els cestodes tripanorrincs

L’ordre Trypanorhyncha (Diesing, 1863) inclou cestodes paràsits de peixos i d’invertebrats marins. Els adults infecten l’estómac i els intestins de taurons i rajades. Els estadis larvals arriben a aquest hoste definitiu perquè infecten la musculatura i la cavitat celomàtica de peixos teleostis que són presa dels condroïctis citats. El consum de peixos infestats per aquests estadis larvals per part de l’ésser humà pot conduir a una infestació accidental que, en la majoria de casos, desencadena reaccions al·lèrgiques i, en menor mesura, reaccions tòxiques.

El coneixement precís de l’impacte dels cestodes tripanorrínquids depèn d’un aprofundiment sobre la taxonomia del grup i sobre els seus cicles vitals. La morfologia dels botris (dos o quatre segons l’espècie), de l’aparell tentacular (integrat per beines i tentacles amb nombrosos ganxos) i de l’escòlex permet la identificació dels adults. Aquest aparell en les larves és menys diferenciat, tot i que ja hi ha presència d’escòlex i de botris, i una armadura tentacular. Les tècniques de taxonomia molecular, particularment del gen 18S rRNA, han ajudat a esclarir la sistemàtica del grup.

En aquesta recerca s’analitza el resultat d’una prospecció parasitològica de peixos marins del litoral d’Alexandria a la cerca de metacèstodes tripanorrínquids. Han participat Kareem Morsy (del Departament de Biologia del Col·legi de Ciència de la Universitat Rei Khalid, d’Abha; i de la Universitat del Cairo), Saad Bin Dajem (Abha), Mohammed Al-Kahtani (Abha), Attalla El-Kott (Abha; i Departament de Zoologia de la Facultat de Ciència de la Universitat Damanhour), Essam Ibrahim (Abha; i del Departament de Control de Qualitat i Recerca de Productes Sanguinista de l’Organització Nacional de Recerca i Control de Productes Biològics del Cairo), Hamida Hamdi (Cairo i Departament de Biologia de la Facultat de Ciència de la Universitat Taif), Amin Al-Doaiss (Abha i Departament d’Anatomia i Histologia de la Facultat de Medicina de la Universitat de Sana’a), Mohamed Abumandour (de la Unitat d’Anatomia i Embriologia de la Facultat de Medicina Veterinària de la Universitat d’Alexandria), Haitham El-Mekkawy (Abha), Diaa Massoud (del Departament de Biologia del Col·legi de Ciència de la Universitat Jouf, de Sakaka), Asmaa Adel (del Departament de Zoologia de la Facultat de Ciència de la Universitat de la Vall del Sud, de Qena) i Shams Abd El-Kareem (del Departament de Zoologia de la Facultat de Ciència de la Universitat de Minia). Ela recerca es finançà a través de l’ajut a grans grups per part del Deganat de Recerca Científica de la Universitat Rei Khalid. L’article fou tramès a la Revista Brasileira de Parasitologia Veterinária el 21 de febrer. Després d’un procés de revisió, fou acceptat el 10 de maig, i publicat el 6 de juny.

75 espècimens de peixos marins

Al llarg del 2020, des de diversos indrets de la costa d’Alexandria, els investigadors esperaven les barques que tornaven de la pesca. En total adquiriren 75 espècimens, que eren transportats al laboratori, on se’ls identificava morfològicament.

Aquests 75 espècimens es distribuïen en quatre espècies:
– 15 espècimens de círvia (Seriola dumerili Risso, 1810; família dels caràngids).
– 20 espècimens de sorell déntol (Pseudocarans dentex Bloch & Schneider, 1801; família dels caràngids).
– 17 espècimens d’Epinephelus haifensis Ben Tuvia, 1953; família dels serrànids.
– 23 espècimens d’anfós rosat (Mycteroperca rubra Bloch, 1793; família dels serrànids).

Els espècimens eren dissecionats. Els blastocists recuperats eren aïllats en una solució salina al 7%, on patien una ruptura que alliberava les larves enrotllades. Les larves eren passades a una solució calenta de formalina al 10% perquè quedessin fixades entre dos portaobjectes. Les larves fixades eren seguidament rentades, tenyides amb camí d’alum i àcid acètic, deshidratades en una sèrie ascendent de solucions etanòliques, aclarides amb oli de clavell d’espècie i xilè, i muntades permanentment en bàlsam de Canadà. D’aquesta manera, les larves eren examinades, fotografiades en un microscopi BX53 i dibuixades a través d’una càmera lúcida. Fotografies i dibuixos servien per fer les mesures anatòmiques en mil·límetres.

Una fracció de les larves eren tamponades en glutaraldehid i post-fixades en tetròxid d’osmi, per tal de fer un estudi per microscòpia electrònica de rastreig.

D’una part de les mostres preservades es feia extracció d’ADN genòmic. D’aquest extracte d’ADN es feia una PCR amb els encebadors 1F 5′–AACCTGGTTGATCCTGCCAG–3′ i 1528R 5′–TGATCCTTCTGCAGGTTCACCTAC–3′: els amplicons cobreix una zona del gen 18S rRNA. Les seqüències obtingudes d’aquests amplicons eren analitzades per BLAST sobre la base de dades del GenBank.

Quatre espècies de cestodes tripanorrincs descrites per primera vegada a l’àrea investigada

Dels 75 peixos examinats resultaren larves de cestodes tripanorrincs pertanyents a quatre espècies diferents:
Callitetrarhynchus gracilis, present en 7 de les 15 Seriola dumerili.
Callitetrarhynchus speciosus, present en 10 de les 20 Pseudocarans dentex).
Protogrillotia zerbiae, present en 13 de les 17 Epinephelus haifensis.
Grillotia brayi, present en 15 dels 23 Mycteroperca rubra.

En tots quatre casos som davant del primer registre en la localitat investigada, cosa que referma els autors en la idea de la insuficiència del coneixement biogeogràfic d’aquest grup de paràsits.

La majoria de les larves foren trobades en la cavitat corporal i en els mesenteris. Les larves s’hi trobaven encapsulades en blastocists blanquinosos. Després de la ruptura induïa en el laboratori, dels blastocists emergien plerocerci.

Les larves recuperades en aquest estudi es conserven en la Secció de Paràsits del Departament de Zoologia de la Facultat de Ciència de la Universitat del Cairo. Les seqüències de 18S rRNA han estat dipositades en el GenBank.

En la preparació del peix per a la comercialització, Morsy et al. recomanen retirar els blastocists de cestodes tripanorrincs. Una bona higiene alimentària ha de considerar tant el fet que els consumidors refusen els peixos infestats pel seu aspecte repulsiu, com el fet que en cas de consumir-los crus s’exposen a una infecció accidental i a reaccions al·lèrgiques.

Lligams:

Larval cestodes infecting commercial fish of Alexandria coast along the Mediterranean Sea: morphology and phylogeny. Kareem Morsy, Saad Bin Dajem, Mohammed Al-KahtaniAttalla El-kottEssam IbrahimHamida HamdiAmin Al-DoaissMohamed AbumandourHaitham El-MekkawyDiaa MassoudAsmaa AdelShams Abd El-Kareem. Rev. Bras. Parasitol. Vet. 31: e003022 (2022).

Arxivat a Ciència i Tecnologia

Podeu escriure el vostre comentari aquí:

Fill in your details below or click an icon to log in:

WordPress.com Logo

Esteu comentant fent servir el compte WordPress.com. Log Out /  Canvia )

Twitter picture

Esteu comentant fent servir el compte Twitter. Log Out /  Canvia )

Facebook photo

Esteu comentant fent servir el compte Facebook. Log Out /  Canvia )

S'està connectant a %s

Aquest lloc utilitza Akismet per reduir els comentaris brossa. Apreneu com es processen les dades dels comentaris.

%d bloggers like this: