L’assaig clínic DINAMIC: Dieta, endocannabinoids i microbiota intestinal (Nutrició mediterrània, 12/2021)

Paola Vitaglione és professora de fisiologia al Dipartimento di Agraria de la Universitat de Nàpols Frederic II. Forma part de la “task force” de la Universitat dedicada a estudis sobre microbioma, és a dir sobre el conjunt de microorganismes que habiten ecosistemes, com ara el sòl, materials vegetals, aliments o el mateix cos humà. En aquest darrer sentit, el grup de recerca de Vitaglione i d’altres grups afins són interessats en les connexions existents entre el microbioma de l’aparell digestiu, la resistència a la insulina i la inflamació. Tenen en ment especialment les malalties metabòliques, i com es poden abordar amb intervencions sobre la dieta, i com afecten aquests canvis alimentaris a factors reguladors com els endocannabinoids o les N-aciletanolamines, tant sobre la composició de la microbiota intestinal com de factors metabòlics (sistema de la insulina) i inflamatoris. En un article a l’European Journal of Nutrition, encapçalat per Silvia Tagliamonte, expliquen els resultats de l’assaig clínic DINAMIC (Arranjament induït per la vida sobre el microbioma digestiu per a la millora de la salut cardiometabòlica), realitzat entre el 2017 i 2019. En aquest assaig participaren 82 persones amb sobrepès o obeses, que seguien una dieta occidental habitual i uns hàbits sedentaris. Foren separats aleatòriament en dos grups, un amb una intervenció alimentària per acostar-se a la dieta mediterrània (43 participants) i un altre que seguia l’alimentació habitual (39 participants). Durant vuit setmanes, es feia un seguiment de marcadors metabòlics i inflamatoris, i de la microbiota fecal. En el grup que adoptà la dieta mediterrània hi hagué una disminució dels nivells plasmàtics d’araquidonoiletanolamida, i un augment dels nivells plasmàtics d’oleiletanolamida (OEA) i palmitoiletanolamida (PEA). Alhora, en la femta augmentaven els nivells del verrucomicrobi Akkermansia muciniphila. Dels participants del grup amb dieta mediterrània, els qui partien del nivells baixos d’OEA/PEA veien disminuït l’índex de resistència a la insulina; els qui partien de nivells més elevats veien disminuïts els nivells sèrics de proteïna reactiva C d’alta sensibilitat. D’aquesta manera, el pas a una dieta mediterrània, encara que sigui isocalòrica, afecta el sistema endocannabinoid i promou la presència d’A. muciniphila en la microbiota digestiva, canvis tots dos independents d’una modificació de pes corporal.

Mapa de color que mostra les relacions entre el sistema d’endocannabinois i la composició específica del microbioma fecal en els participants de l’assaig clínic DINAMIC

L’assaig clínic DINAMIC

Paola Vitaglione, professora de fisiologia del Departament de Ciències Agrícoles de la Universitat de Nàpols, dissenyà aquesta recerca. Danilo Ercolini, professor de microbiologia del mateix departament, aconseguí finançament a través de la Universitat, i de la Iniciativa Europea “Una Dieta Saludable per a una Vida Saludable”, a banda de finançament del Ministeri italià d’Educació, Universitat i Recerca, i de Metagenopolis. Els aliments que es lliuraven als participants provenien d’Agria Spa, Fiammante Icab Spa, Olio Dante Spa i Pastificio Di Martino Spa. La recerca fou conduïda per Silvia Tagliamonte, Manolo Laiola i Rosalia Ferracane (també del Departament de Ciències Agrícoles), Marilena Vitale (del Departament de Medicina Clínica i Cirúrgia de la Unina), Maria Assunta Gallo (del Centro Diagnostico San Ciro, de Portici) i Vitaglione. Hi aportaren materials Ercolini, Nicolas Pons i Victoria Meslier (de la Université Paris-Saclay, l’Institut National de Recherche Pour L’agriculture, l’alimentation Et L’environnement i Metagenopolis) i Vitaglione. Tagliamonte, Vitaglione i Laiola analitzaren les dades i realitzaren les anàlisis estatístiques. Tagliamonte i Vitaglione redactaren l’article original, que fou revisat per Laiola, Meslier i Ercolini. Vitaglione i Ercolini assumeixen la responsabilitat del contingut final, i Vitaglione fou l’autora corresponent amb l’European Journal of Nutrition, que rebé l’article el 20 de desembre. Després d’un procés de revisió fou acceptat el 8 de març, i publicat el dia 24.

Si bé és acceptat que el patró alimentari “mediterrani” és saludable, mentre que el patró “occidental” no ho és, són necessaris assaigs clínics aleatoritzats, dissenyats per monitoritzar sistemes múltiples (microbiòmics, metabòlics, inflamatoris, etc.), per tal de determinar les relacions causals entre el patró alimentari i objectius concrets de salut. El coneixement dels mecanismes fisiològics a través d’aquests assaigs il·luminarà les indicacions d’una nutrició personalitzada. Estudis anteriors, per exemple, han posat de manifest que la dieta mediterrània estimula la presència en el tub digestiu de microorganismes degradadors de la fibra. D’altres estudis indiquen que la dieta mediterrània afavoreix respostes antiinflamatòries.

La inflamació és un element contribuent a la “malaltia metabòlica”. En aquest sentit, el microbioma digestiu, en regular la permeabilitat de les mucoses, afecta la inflamació metabòlica. El bacteri Akkermansia muciniphila, capaç de degradar la mucina, seria un dels microorganismes que promouria una bona salut digestiva i l’homeostasi metabòlica (tolerància a la glucosa, resposta correcta a la insulina, etc.).

El sistema endocannabinoid s’articula al voltant dels receptors de cannabinoids. Els receptors de cannabinoids foren descoberts en el 1988, com els mediadors de les accions dels components psicoactius del cànnabis, i no fou fins més tard com identificà l’existència d’agonistes endògens. Des de llavors hom ha posat de manifest les seves múltiples funcions, entre les quals hi ha la regulació de la microbiota digestiva i del metabolisme. El patró alimentari influeix en els nivells circulants d’endocannabinoids (Ecs) i de N-aciletanolamines (NAEs), i aquests nivells de retruc es relaciones amb la distribució de teixit adipós blanc.

Dieta mediterrània i dieta occidental contrasten, respectivament en:
– carbohidrats de digestió lenta respecte carbohidrats refinats de digestibilitat ràpida.
– greixos insaturats respecte de greixos saturats.
– proteïna vegetal respecte de proteïna animal.

Aquests contrastos van més enllà dels nivells calòrics d’una i altra dieta. A l’assaig clínic DINAMIC, el grup de Vitaglione estudiava durant 8 setmanes 82 subjectes amb sobrepès o obesitat i estil de vida de risc pel que fa a la malaltia metabòlics. A 43 d’aquests 82 subjectes se’ls dissenyà una dieta mediterrània sense alterar el consum energètic habitual de cada participant ni tampoc la ingesta de macronutrients (grup MD). Als altres 39 se’ls feia mantindre el patró alimentari habitual, de tall occidental (grup CT).

Aplicant els protocols de l’estudi, després d’excloure 18 participants, es constatà que el grup MD presentava una disminució del colesterol plasmàtic, alhora que registrava canvis en el microbioma i metaboloma intestinals.

La selecció dels participants per a l’assaig de 8 setmanes

En total, unes 334 persones adultes expressaren interès per participar en aquest estudi. Com a criteris d’inclusió es demanava que fossin homes o dones sans, d’entre 20 i 65 anys, amb un índex de massa corporal superior a 24 kg·m-2. Havien de seguir un patró alimentari occidental, amb menys de 3 plats diaris de fruita o verdura; cap consum de probiòtics, aliments funcionals o suplements alimentaris; consumir no pas més de 2 porcions diàries d’aliments de cereal integral o enriquits amb fibra alimentària. Alhora, havien de seguir un estil de vida sedentari (amb menys de 700 minuts MET per setmana).

Els 82 participants seleccionats prestaren consentiment informat abans de l’inici de l’estudi. Foren aleatoritzats entre els dos braços d’intervenció de l’estudi dissenyat en paral·lel. El grup MD rebia una dieta mediterrània isocalòrica. Al grup CT se’ls demanava de no canviar el patró alimentari que seguien habitualment. Uns i altres havien d’omplir un diari d’aliments, que era revisat cada 2 setmanes.

Entre les mesures antropomètriques que se’ls prenia hi havia:
– la circumferència de cintura, mesurada a mig camí entre la costella inferior i la cresta ilíaca.
– la circumferència de malucs, mesurada al voltant de la porció més àmplia de les natges.
– el pes, mesurat en roba interior.
– l’estatura.
– la composició corporal, mesurada amb una anàlisi d’impedància elèctrica.

Les mostres de sang es prenien per venipunctura en dejuni. S’abocaven un tub separador de sèrum (amb EDTA com a anticoagulant). Se n’obtenia el plasma per centrifugació. Les mostres eren conservades en ultracongelació (- 80 °C). S’hi determinaven els nivells de glucosa, insulina i proteïna C-reactiva (CRP). També s’analitzaven ECs i NAEs per cromatografia líquida acoblada a espectrometria de masses (LC-MS/MS).

La microbiota intestinal era valorada d’acord una anàlisi microbiòmica de la femta. De mostres fecals es feia una extracció d’ADN, a partir del qual es fabricava una genoteca, que era ulteriorment seqüenciada pel mètode d’ió-protó. D’això sortia un mínim de 20 milions de lectures de fragments de 150 parells de nucleòtids.

L’abundància d’A. muciniphila en les mostres fecals era valorada per una PCR quantitativa, que utilitzava com a encebadors CAGCACGTGAAGGTGGGGAC i CCTTGCGGTTGGCTTCAGAT, que amplifiquen una regió del gen de l’ARN ribosòmic 16S. Com a control s’utilitzava una amplificació amb els encebadors bacterians universals ACTCCTACGGGAGGCAGCAG i ATTACCGCGGCTGCTGG.

La mida de mostra necessària per a l’estudi s’havia planificat d’acord amb una anàlisi estatística sobre variacions en els nivells d’ECs i NAEs en estudis previs, segons la qual hi havia suficient amb 39 participants per grup.

En l’anàlisi estatístic, cada variable quantitativa fou assajada quant a la normalitat de distribució i, si mostrava un biaix positiu, se la transformava amb el logaritme natural. Les variables que seguien una distribució normal eren analitzades amb un test Kolmogorov-Smirnov, i un test T independent pel que fa a les diferències entre el grup CT i el grup MD en la línia de base. Amb una ANOVA de 2 sentits amb mesura repetida es comprovaven les diferents internes dins de cada grup durant el període d’estudi. Les variables que no seguien una distribució normal eren analitzades amb un test de Wilcoxon. Les correlacions entre ECs, NAEs, microbioma i dieta eren estudiades amb un rang aparella de Spearman.

La dieta mediterrània disminueix els nivells plasmàtics d’anandamida

Dels 82 participants de l’estudi, 43 eren dones i 39 homes. L’índex de massa corporal era de 31,1 ± 0,5 kg·m-2 i l’edat de 43 ± 1,4 anys. Dels 43 participants del grup MD, 22 eren dones i 21 homes. Del grup CT, 21 eren dones i 18 homes.

Els dos grups eren semblants en la línia de base per a la majoria de variables. El grup CT, no obstant, mostrava de partida un major consum d’ous.

Durant les 8 setmanes d’intervenció, els participants del grup MD disminuïen el consum de productes de gra refinat, esnacs, olis, greixos i carn, alhora que augmentaven la ingesta de verdures, llegums, productes de gra integral, peix, fruita i fruits secs. Tagliamonte et al. avaluen aquests canvis a través de l’índex mediterrani italià (IMI).

Pel que fa al sistema d’endocannabinoids, en la línia de base, no hi ha diferències entre sexes pel que fa a la concentració plasmàtica d’OEA (oleiletanolamida), LEA (linoleoiletanolamida), PEA (palmitoiletanolamida), AEA (anandamida), 2-AG (2-araquidonoglicerol), ni tampoc per a les ratio OEA/AEA i OEA/PEA.

Ara bé, en el grup MD, després de 8 setmanes, hi havia una reducció del 9,1% de la concentració plasmàtica d’AEA. No eren afectades, però, les concentracions de 2-AG, LEA, OEA o PEA. Sí que hi havia un augment del 5,9% de la ratio OEA/PEA i del 14,6% de la ratio OEA/AEA. S’observaren associacions negatives entre la ratio OEA/AEA i la circumferència de cintura, així com entre aquesta ratio i la circumferència de maluc.

Correlació entre la caiguda de l’anandamida i l’augment de la presència d’Akkermansia muciniphila

Després de 8 setmanes, el microbioma fecal del grup MD es veia enriquit significativament en els nivells dels bacteris lacnospiracis Roseburia faecis i R. hominis. Aquest enriquiment ja s’observava a les 4 setmanes. També hi havia un augment del bacteri ruminococaci Faecalibacterium prausnitzii, capaç de degradar fibra alimentària.

Paral·lelament, queien els nivells d’altres ruminococacis, Ruminococcus torques i R. gnavus.

Els nivells d’Akkermansia muciniphila augmentaven a les 8 setmanes en el grup MD. Hi havia una correlació negativa entre l’abundància d’A. muciniphila i els nivells plasmàtics d’OEA, PEA i AEA. Semblantment, hi havia una correlació positiva entre els nivells fecals d’A. muciniphila i les ratios OEA/PEA i OEA/AEA.

Les concentracions plasmàtiques d’anandamida (AEA) també es relacionen negativament amb la presència del coriobacteriaci Eggerthella.

D’altres bacteris mostraven semblantment associacions negatives amb els nivells d’AEA i la ratio OEA/PEA: Intestinimonas butyriciproducens, Bifidobacterium longum, Roseburia hominis, Faecalibacterium prausnitzii, Prevotella copri.

Hi havia correlació positiva amb l’adhesió a la dieta mediterrània (IMI) i la ratio OEA/PEA. Aquesta ratio, alhora, es correlacionava positivament amb el consum diari de verdures, i negativament amb el consum de refrescos, esnacs, carn i productes de gra refinat.

La ratio OEA/AEA es correlacionava negativament amb el consum d’ous, refrescos, esnacs, carn, productes de gra refinat, peix, làctics i llegums.

Les concentracions plasmàtics de 2-AG correlacionaven negativament amb el consum de carn, productes de gra refinat, peix, làctics i llegums. Tots aquests productes es correlacionaven positivament amb els nivells plasmàtics d’anandamida i de NAEs.

La ratio OEA/PEA en la resposta individual a l’adopció de dieta mediterrània

Tagliamonte et al. agruparen els participants MD en quartils d’acord amb la ratio OEA/PEA que presentaven de base. El quartil inferior (Q1) era el que mostrava un major augment (26,7%) de la ratio OEA/PEA a les 4 setmanes d’iniciar la MD, mentre que en el quartil superior (Q4) no s’observava diferència ni tan sols a les 8 setmanes. Els participants de Q1 eren els que mostraven, al cap de les 8 setmanes, una reducció del 23,9% en la resistència a la insulina, valorada per índex HOMA.

Els participants de Q4 mostraven, al cap de 8 setmanes de MD, una disminució en els nivells de proteïna C-reactiva-hs.

Entre Q1 i Q4 hi havia diferències d’entrada en el microbioma fecal, ja que els de Q4 mostraven valors superiors de bacteris com Roseburia faecis, Bacteroides dorei, Bacteroides intestinalis, Bifidobacterium longum i Anaerostipes hadrus. En canvis, en els de Q1 hi havia valors superiors de Blautia, Coprococcus i Alistipes. En resum, els participants de Q4 tenien una major presència de bacteris amb capacitat de degrada glicocolat, glucosa i lactosa.

Què diferencia, doncs, els participants Q1 dels participants Q4? De fet, no hi ha diferències ni en la ingesta calòrica, ni en la ingesta de fibra, greixos, carbohidrats, proteïnes, o alcohol, ni tampoc en l’índex de massa corporal o la composició corporal. La diferència és que els participants Q1 tenen un major consum de productes de gra refinat, de carn i d’esnacs que els Q4.

Microbioma intestinal, resistència a la insulina i inflamació

N’hi ha prou amb 8 setmanes d’un canvi cap a una dieta mediterrània, encara que sigui isocalòrica, per disminuir els nivells d’anandamida i augmentar les ratios OEA/PEA i OEA/AEA. Aquests canvis serien promoguts per l’augment de la ingesta d’àcids grassos poliinsaturats (peix, fruits secs) en detriment dels àcids grassos saturats (carn, làctics). Aquestes modificacions s’acompanyen d’una reducció dels nivells plasmàtics de colesterol.

L’anandamida (AEA) participa en els efectes de l’obesitat sobre la integritat de la barrera intestinal: té un efecte permeabilitzador i pro-inflamatori.

Contràriament, A. muciniphila és un bacteri que contribueix al manteniment de la salut intestinal i de l’homeostasi metabòlica. També hi contribuiran Intestinimonas butyriciproducens, Bifidobacterium longum, Roseburia hominis i Faecalibacterium prausnitzii.

Tagliamonte et al. consideren que els nivells plasmàtics d’AEA podrien constituir un marcador d’alteracions en la permeabilitat de la mucosa intestinal i de problemes en la microbiota (disbiosis). Contràriament, la ratio OEA/PEA seria un indicador d’una correcta funció de barrera per part de la mucosa intestinal.

Per corroborar aquestes hipòtesis, caldria realitzar mesures de la permeabilitat intestinal. En tot cas, el sistema endocannabinoid juga un paper entre la dieta, la funció digestiva i l’estat inflamatori. Seguir els paràmetres d’aquest sistema (ratio plasmàtica OEA/PEA) ajudaria a orientar individualment les intervencions de promoció d’una dieta mediterrània.

Lligams:

Mediterranean diet consumption affects the endocannabinoid system in overweight and obese subjects: possible links with gut microbiome, insulin resistance and inflammation. Silvia Tagliamonte, Manolo Laiola, Rosalia Ferracane, Marilena Vitale, Maria A. Gallo, Victoria Meslier, Nicolas Pons, Danilo Ercolini & Paola Vitaglione. Eur. J. Nutr. (2021).

Diet-induced Arrangement of the Gut Microbiome for Improvement of Cardiometabolic Health (DINAMIC), a ClinicalTrials.gov.

Project: PRJEB33500, seqüències metagenòmiques generades en l’assaig clínic DINAMIC, publicades en l’European Nucleotide Archive (ENA).

Arxivat a Ciència i Tecnologia
%d bloggers like this: